91ɫƬ

Life

A brief history of the human genome

From the first cells to the dawn of our species, take a whirlwind tour through 3 billion years of evolution

By Michael Le Page

12 September 2012

New Scientist. Science news and long reads from expert journalists, covering developments in science, technology, health and the environment on the website and the magazine.

Swapping genes during sex helps organisms weed out the bad mutations from the good

Laguna Design/Science Photo Library

GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATA GCGTATATTAAAGTTGCTGCAGTTAAAAAG

It looks like gibberish, but this DNA sequence is truly remarkable. It is present in all the cells of your body, in your cat or dog, the fish on your plate, the bees and butterflies in your garden and in the bacteria in your gut. In fact, wherever you find life on Earth, from boiling hot vents deep under the sea to frozen bacteria in the clouds high above the planet, you find this sequence. You can even find it in some things that aren’t technically alive, such as the giant viruses known as mimiviruses.

This sequence is so widespread because it evolved in the common ancestor of all life, and as it carries out a crucial process, it has barely changed ever since. Put another way, some of your DNA is an unimaginable 3 billion years old, passed down to you in an unbroken chain by your trillions of ancestors.

Other bits of your DNA are brand new. You have around 100 mutations in your genome that are not present in your mother or father, ranging from one or two-letter changes to the loss or gain of huge chunks of DNA.

We can tell which bits of our DNA are old or new by comparing genomes. Comparing yours with those of your brother or sister, for instance, would reveal brand new mutations. Contrasting the genomes of people and animals reveals much older changes.

“Some of your DNA is an unimaginable 3 billion years old… Other bits are brand new”…

Sign up to our weekly newsletter

Receive a weekly dose of discovery in your inbox. We'll also keep you up to date with New Scientist events and special offers.

Sign up

To continue reading, today with our introductory offers

or

Existing subscribers

Sign in to your account
Piano Exit Overlay Banner Mobile Piano Exit Overlay Banner Desktop